Search DNA, RNA, and protein sequences across public archives using annotated de Bruijn graphs with exact matching or sensitive alignment.
For questions, bug reports, and feature requests, please open a GitHub issue.
For urgent questions, reach us on Discord or email metagraph@inf.ethz.ch.
You can also use our feedback form.
Web limits: Standard jobs support up to 10 sequences (55,000 characters total). Large jobs support up to 10 MB with no sequence count limit.
See the Databases page for live coverage and whether an index includes counts or coordinates.
View databasesMetaGraph returns hits organized by database and accession. Similar to BLAST, results are ranked by relevance, but instead of E-values, MetaGraph uses discovery threshold and k-mer matching to identify significant matches.
If your search returns no hits, consider:
selectedAccessions, topLabels, discoveryThreshold, sequenceType, and moleculeFilter. The query sequence is not included for privacy; the recipient pastes their own sequence and runs the search.See the dedicated Examples page, or run a pre‑filled search:
This example has been tested and verified to work.
curl -X POST "https://metagraph.ethz.ch:8081/search" \
-H "Content-Type: application/json" \
-d '{
"queries": [
{
"db": "refseq33m",
"q": "ATGCGATCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAG"
}
]
}'Note: Use just the sequence (no FASTA header)
curl "https://metagraph.ethz.ch:8081/search/{search_id}/status"Keep checking until status is "completed"
curl "https://metagraph.ethz.ch:8081/search/{search_id}/results"Install the latest release on Linux or Mac OS X with Anaconda:
conda install -c bioconda -c conda-forge metagraphIf docker is available on the system, immediately get started with
docker pull ghcr.io/ratschlab/metagraph:master
docker run -v ${HOME}:/mnt ghcr.io/ratschlab/metagraph:master \
metagraph build -v -k 10 -o /mnt/transcripts_1000 /mnt/transcripts_1000.faand replace ${HOME} with a directory on the host system to map it under /mnt in the container.
By default, it executes the binary compiled for the DNA alphabet {A,C,G,T}. To run the binary compiled for the DNA5 or Protein alphabet, just replace metagraph with metagraph_DNA5 or metagraph_Protein, respectively, e.g.:
docker run -v ${HOME}:/mnt ghcr.io/ratschlab/metagraph:master \
metagraph_Protein build -v -k 10 -o /mnt/graph /mnt/protein.faFor more complex workflows, consider running docker in the interactive mode:
$ docker run -it --entrypoint /bin/bash -v ${HOME}:/mnt ghcr.io/ratschlab/metagraph:master
root@5c42291cc9cf:/# ls /mnt/
root@5c42291cc9cf:/# metagraph --versionTo compile from source (e.g., for builds with custom alphabet or other configurations), see documentation online.
./metagraph build./metagraph annotate./metagraph transform_anno./metagraph queryDATA="../tests/data/transcripts_1000.fa"
./metagraph build -k 12 -o transcripts_1000 $DATA
./metagraph annotate -i transcripts_1000.dbg --anno-filename -o transcripts_1000 $DATA
./metagraph query -i transcripts_1000.dbg -a transcripts_1000.column.annodbg $DATA
./metagraph stats -a transcripts_1000.column.annodbg transcripts_1000.dbg./metagraphSimple build
./metagraph build -v --parallel 30 -k 20 --mem-cap-gb 10 \
-o <GRAPH_DIR>/graph <DATA_DIR>/*.fasta.gz \
2>&1 | tee <LOG_DIR>/log.txtBuild with disk swap (use to limit the RAM usage)
./metagraph build -v --parallel 30 -k 20 --mem-cap-gb 10 --disk-swap <GRAPH_DIR> \
-o <GRAPH_DIR>/graph <DATA_DIR>/*.fasta.gz \
2>&1 | tee <LOG_DIR>/log.txtBuild from k-mers filtered with KMC
K=20
./KMC/kmc -ci5 -t4 -k$K -m5 -fm <FILE>.fasta.gz <FILE>.cutoff_5 ./KMC
./metagraph build -v -p 4 -k $K --mem-cap-gb 10 -o graph <FILE>.cutoff_5.kmc_pre./metagraph annotate -v --anno-type row --fasta-anno \
-i primates.dbg \
-o primates \
~/fasta_zurich/refs_chimpanzee_primates.fa1. Cluster columns
./metagraph transform_anno -v --linkage --greedy \
-o linkage.txt \
--subsample R \
-p NCORES \
primates.column.annodbg2. Construct Multi-BRWT
./metagraph transform_anno -v -p NCORES --anno-type brwt \
--linkage-file linkage.txt \
-o primates \
--parallel-nodes V \
-p NCORES \
primates.column.annodbg./metagraph query -v -i <GRAPH_DIR>/graph.dbg \
-a <GRAPH_DIR>/annotation.column.annodbg \
--min-kmers-fraction-label 0.8 --labels-delimiter ", " \
query_seq.fa./metagraph align -v -i <GRAPH_DIR>/graph.dbg query_seq.fa./metagraph assemble -v <GRAPH_DIR>/graph.dbg \
-o assembled.fa \
--unitigs./metagraph assemble -v <GRAPH_DIR>/graph.dbg \
--unitigs \
-a <GRAPH_DIR>/annotation.column.annodbg \
--diff-assembly-rules diff_assembly_rules.json \
-o diff_assembled.faStats for graph
./metagraph stats graph.dbgStats for annotation
./metagraph stats -a annotation.column.annodbgStats for both
./metagraph stats -a annotation.column.annodbg graph.dbgSee the Databases page for the live snapshot date and coverage.
INSDC subsets (Microbe, Fungi, Plants, Metazoa incl. Human/Mouse), SRA‑MetaGut, RefSeq, UHGG, Tara Oceans, UniParc. See Databases for the active set.
Standard jobs: up to 10 sequences, 55,000 characters total. Large jobs: up to 10 MB, no sequence count limit. For even larger runs, use the API or command line interface.
Indexes are versioned; some include counts or coordinates. Record index name/version and the detailed search parameters.
Raw‑read indexes use moderate cleaning (MetaGraph and Logan use different strategies to reduce/remove infrequent k-mers). Assembled/reference/protein indexes are indexed losslessly with coordinates.
Open the Search page, configure your databases / accessions / parameters, and copy the URL from the address bar — it's kept in sync with your selection. The recipient pastes that URL into their browser to load the same setup, then enters their own sequence and runs the search. The query sequence is intentionally not included in the URL.